MirGeneDB

MirGeneDB ID

Mmu-Mir-17-P3c

Family name MIR-17 (all species)
Seed AAAGUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-106b
Paralogues Mmu-Mir-17-P1a  Mmu-Mir-17-P1b  Mmu-Mir-17-P1c  Mmu-Mir-17-P2a  Mmu-Mir-17-P2b  Mmu-Mir-17-P3a  Mmu-Mir-17-P3b 
Orthologues Ami-Mir-17-P3c  Bta-Mir-17-P3c  Cfa-Mir-17-P3c  Cpi-Mir-17-P3c  Cpo-Mir-17-P3c  Dno-Mir-17-P3c  Ete-Mir-17-P3c  Hsa-Mir-17-P3c  Mml-Mir-17-P3c  Ocu-Mir-17-P3c  Rno-Mir-17-P3c  Sto-Mir-17-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr5: 138165747-138165807 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3c)
Mir-92-P2c chr5: 138165332-138165391 [-] UCSC Ensembl
Mir-17-P1c chr5: 138165535-138165596 [-] UCSC Ensembl
Mir-17-P3c chr5: 138165747-138165807 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCUUCCCUCCUACCAGCCCUGCUGGGACUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCUGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGGGCACGUGCAACGCCCAUGGA
Get precursor sequence
Structure
        10         20         30        40        50          
CUCCUUCCCUCCUACCA-          -|ACUA       G       AGAUAGUGGUCC 
                  GCCCUGCUGG G    AAGUGCU ACAGUGC            \
                  CGGGACGACC C    UUCAUGG UGUCACG            U
AGGUACCCGCAACGUGCA          U^GUCG       G       CCAUCGUGUCUC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites +1 and +2 relative to what is annotated here.
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-17-P3c_5p

MirBase accessionMIMAT0000386
Sequence
0- UAAAGUGCUGACAGUGCAGAUA -22
Get sequence
Validated targets microrna.org: MIMAT0000386
TargetScanVert: mmu-miR-106b-5p
miRDB: MIMAT0000386
Star sequence

Mmu-Mir-17-P3c_3p*

MirBase accessionMIMAT0004582
Sequence
40- CCGCACUGUGGGUACUUGCUG -61
Get sequence
Validated targets microrna.org: MIMAT0004582
TargetScanVert: mmu-miR-106b-3p
miRDB: MIMAT0004582