MirGeneDB

MirGeneDB ID

Mmu-Mir-17-P3b

Family name MIR-17 (all species)
Seed AAAGUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-20b
Paralogues Mmu-Mir-17-P1a  Mmu-Mir-17-P1b  Mmu-Mir-17-P1c  Mmu-Mir-17-P2a  Mmu-Mir-17-P2b  Mmu-Mir-17-P3a  Mmu-Mir-17-P3c 
Orthologues Aca-Mir-17-P3b  Bta-Mir-17-P3b  Cfa-Mir-17-P3b  Cli-Mir-17-P3b  Cpi-Mir-17-P3b  Cpo-Mir-17-P3b  Dno-Mir-17-P3b  Dre-Mir-17-P3b1  Ete-Mir-17-P3b  Gga-Mir-17-P3b  Hsa-Mir-17-P3b  Mdo-Mir-17-P3b  Mml-Mir-17-P3b  Oan-Mir-17-P3b  Ocu-Mir-17-P3b  Rno-Mir-17-P3b  Sha-Mir-17-P3b  Tgu-Mir-17-P3b  Xtr-Mir-17-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chrX: 52742121-52742181 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3b)
Mir-92-P2b chrX: 52741697-52741761 [-] UCSC Ensembl
Mir-92-P1b chrX: 52741853-52741913 [-] UCSC Ensembl
Mir-19-P2b chrX: 52741991-52742056 [-] UCSC Ensembl
Mir-17-P3b chrX: 52742121-52742181 [-] UCSC Ensembl
Mir-17-P2b chrX: 52742341-52742403 [-] UCSC Ensembl
Mir-17-P1b chrX: 52742505-52742563 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAGAAGAACAAGCUCGGAUCCUAGUAGUGCCAAAGUGCUCAUAGUGCAGGUAGUUUUUAUACCACUCUACUGCAGUGUGAGCACUUCUAGUACUCCUGGAUCAACCAAGGUCUUGUUGAAG
Get precursor sequence
Structure
        10           20        30         40        50          
UAGAAGAACAAGCUCGG---|   U  U     CA-           G     G   UUUUUA 
                    AUCC AG AGUGC   AAGUGCUCAUA UGCAG UAG      \
                    UAGG UC UCAUG   UUCACGAGUGU ACGUC AUC      U
GAAGUUGUUCUGGAACCAAC^   -  C     AUC           G     -   UCACCA 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-17-P3b_5p

MirBase accessionMIMAT0003187
Sequence
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
Validated targets microrna.org: MIMAT0003187
TargetScanVert: mmu-miR-20b-5p
miRDB: MIMAT0003187
Star sequence

Mmu-Mir-17-P3b_3p*

MirBase accessionMIMAT0004788
Sequence
38- ACUGCAGUGUGAGCACUUCUAGU -61
Get sequence
Validated targets microrna.org: MIMAT0004788
TargetScanVert: mmu-miR-20b-3p
miRDB: MIMAT0004788