MirGeneDB

MirGeneDB ID

Mmu-Mir-17-P1b

Family name MIR-17 (all species)
Seed AAAGUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-106a
Paralogues Mmu-Mir-17-P1a  Mmu-Mir-17-P1c  Mmu-Mir-17-P2a  Mmu-Mir-17-P2b  Mmu-Mir-17-P3a  Mmu-Mir-17-P3b  Mmu-Mir-17-P3c 
Orthologues Aca-Mir-17-P1b  Bta-Mir-17-P1b  Cfa-Mir-17-P1b  Cli-Mir-17-P1b  Cpi-Mir-17-P1b  Cpo-Mir-17-P1b  Dno-Mir-17-P1b  Ete-Mir-17-P1b  Gga-Mir-17-P1b  Hsa-Mir-17-P1b  Mdo-Mir-17-P1b  Mml-Mir-17-P1b  Oan-Mir-17-P1b  Ocu-Mir-17-P1b  Rno-Mir-17-P1b  Sha-Mir-17-P1b  Tgu-Mir-17-P1b  Xtr-Mir-17-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chrX: 52742505-52742563 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P1b)
Mir-92-P2b chrX: 52741697-52741761 [-] UCSC Ensembl
Mir-92-P1b chrX: 52741853-52741913 [-] UCSC Ensembl
Mir-19-P2b chrX: 52741991-52742056 [-] UCSC Ensembl
Mir-17-P3b chrX: 52742121-52742181 [-] UCSC Ensembl
Mir-17-P2b chrX: 52742341-52742403 [-] UCSC Ensembl
Mir-17-P1b chrX: 52742505-52742563 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUACACUCCUGGAGUAUGCCUUGGCCAUGUCAAAGUGCUAACAGUGCAGGUAGCUUUUUGAGUUCUACUGCAGUGCCAGCACUUCUUACAUUACCAUGGUGAUUUAAUCAGAGGCCGCU
Get precursor sequence
Structure
        10          20        30         40        50         
UUACACUCCUGGAGUAU--   U   CC    CA-|      AA  G     G   CUUUU 
                   GCC UGG  AUGU   AAGUGCU  CA UGCAG UAG     \
                   UGG ACC  UACA   UUCACGA  GU ACGUC AUC     U
UCGCCGGAGACUAAUUUAG   U   AU    UUC^      CC  G     -   UUGAG 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 on the 3p arm relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-17-P1b_5p

MirBase accessionMIMAT0000385
Sequence
0- CAAAGUGCUAACAGUGCAGGUAG -23
Get sequence
Validated targets microrna.org: MIMAT0000385
TargetScanVert: mmu-miR-106a-5p
miRDB: MIMAT0000385
Star sequence

Mmu-Mir-17-P1b_3p*

MirBase accessionMIMAT0017009
Sequence
36- ACUGCAGUGCCAGCACUUCUUAC -59
Get sequence
Validated targets TargetScanVert: mmu-miR-106a-3p
miRDB: MIMAT0017009