MirGeneDB

MirGeneDB ID

Mmu-Mir-15-P1d-v3

Family name MIR-15 (all species)
Seed AACAUGA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-322
Paralogues Mmu-Mir-15-P1a  Mmu-Mir-15-P1b  Mmu-Mir-15-P1c  Mmu-Mir-15-P1d-v1  Mmu-Mir-15-P1d-v2  Mmu-Mir-15-P2a  Mmu-Mir-15-P2b  Mmu-Mir-15-P2c  Mmu-Mir-15-P2d 
Orthologues Aca-Mir-15-P1d  Ami-Mir-15-P1d  Bta-Mir-15-P1d  Cfa-Mir-15-P1d  Cin-Mir-15-P1  Cli-Mir-15-P1d  Cpi-Mir-15-P1d  Cpo-Mir-15-P1d  Dno-Mir-15-P1d  Ete-Mir-15-P1d  Gga-Mir-15-P1d  Hsa-Mir-15-P1d  Mdo-Mir-15-P1d-v1  Mdo-Mir-15-P1d-v2  Mml-Mir-15-P1d  Oan-Mir-15-P1d  Ocu-Mir-15-P1d  Rno-Mir-15-P1d1  Rno-Mir-15-P1d2  Sha-Mir-15-P1d  Tgu-Mir-15-P1d  Xtr-Mir-15-P1d 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(mm10)
chrX: 53054268-53054329 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1d-v3)
Mir-450-P3 chrX: 53048008-53048065 [-] UCSC Ensembl
Mir-450-P1 chrX: 53048171-53048227 [-] UCSC Ensembl
Mir-450-P2 chrX: 53048304-53048360 [-] UCSC Ensembl
Mir-542 chrX: 53049414-53049474 [-] UCSC Ensembl
Mir-351 chrX: 53053276-53053338 [-] UCSC Ensembl
Mir-15-P2d chrX: 53053987-53054049 [-] UCSC Ensembl
Mir-15-P1d-v3 chrX: 53054268-53054329 [-] UCSC Ensembl
Mir-15-P1d-v2 chrX: 53054269-53054328 [-] UCSC Ensembl
Mir-15-P1d-v1 chrX: 53054270-53054327 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGCCCCCACCCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAAUGUAGAAGGUGGGGACC
Get precursor sequence
Structure
        10         20         30        40        50        60
CGGCCCCCACCCUCGUUGA-   -|      C  CA     AA           GAGUAUU 
                    CUC CGAAGGG UG  GCAGC  UUCAUGUUUUG       G
                    GGG GCUUCCC AC  CGUCG  AAGUACAAAAC       C
CCAGGGGUGGAAGAUGUAAG   U^      C  AA     CG           UUGGAAC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentMouse appears to be arm switched relative to most other vertebrates examined.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-15-P1d-v3_5p*

MirBase accessionMIMAT0000548
Sequence
0- UGCAGCAGCAAUUCAUGUUUUG -22
Get sequence
Validated targets microrna.org: MIMAT0000548
TargetScanVert: mmu-miR-322-5p
miRDB: MIMAT0000548
Mature sequence

Mmu-Mir-15-P1d-v3_3p

MirBase accessionMIMAT0000549
Sequence
40- AAACAUGAAGCGCUGCAACACC -62
Get sequence
Validated targets microrna.org: MIMAT0000549
TargetScanVert: mmu-miR-322-3p
miRDB: MIMAT0000549