MirGeneDB

MirGeneDB ID

Mmu-Mir-15-P1c

Family name MIR-15 (all species)
Seed AGCAGCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-497a
Paralogues Mmu-Mir-15-P1a  Mmu-Mir-15-P1b  Mmu-Mir-15-P1d-v1  Mmu-Mir-15-P1d-v2  Mmu-Mir-15-P1d-v3  Mmu-Mir-15-P2a  Mmu-Mir-15-P2b  Mmu-Mir-15-P2c  Mmu-Mir-15-P2d 
Orthologues Ami-Mir-15-P1c  Bta-Mir-15-P1c  Cfa-Mir-15-P1c  Cin-Mir-15-P1  Cpo-Mir-15-P1c  Dno-Mir-15-P1c  Dre-Mir-15-P1c  Ete-Mir-15-P1c  Hsa-Mir-15-P1c  Mdo-Mir-15-P1c  Mml-Mir-15-P1c  Oan-Mir-15-P1c  Ocu-Mir-15-P1c  Rno-Mir-15-P1c  Sha-Mir-15-P1c  Sto-Mir-15-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(mm10)
chr11: 70234730-70234791 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1c)
Mir-15-P1c chr11: 70234730-70234791 [+] UCSC Ensembl
Mir-15-P2c chr11: 70235062-70235122 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCGACCCACCCCAGUCCUGCCCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGGGUAUGGGAGGCACCGAUGAGCCUG
Get precursor sequence
Structure
        10          20        30        40        50        60
UCUCGACCCACCCCAGU-  -|    C   CCC    G    C         UACGGCACU 
                  CC UGCCC CGC   AGCA CACA UGUGGUUUG         G
                  GG AUGGG GCG   UUGU GUGU ACACCAAAC         U
GUCCGAGUAGCCACGGAG  U^    A   AGA    G    C         CUGCACCGG 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-15-P1c_5p

MirBase accessionMIMAT0003453
Sequence
0- CAGCAGCACACUGUGGUUUGUA -22
Get sequence
Validated targets microrna.org: MIMAT0003453
TargetScanVert: mmu-miR-497a-5p
miRDB: MIMAT0003453
Star sequence

Mmu-Mir-15-P1c_3p*

MirBase accessionMIMAT0017247
Sequence
40- CAAACCACACUGUGGUGUUAGA -62
Get sequence
Validated targets TargetScanVert: mmu-miR-497a-3p
miRDB: MIMAT0017247