MirGeneDB

MirGeneDB ID

Mmu-Mir-142-v2

Family name MIR-142 (all species)
Seed UAGUGUU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-142a
Paralogues Mmu-Mir-142-v1  Mmu-Mir-142-v3  Mmu-Mir-142-v4 
Orthologues Bta-Mir-142-v2  Cfa-Mir-142-v2  Cpo-Mir-142-v2  Dno-Mir-142-v2  Ete-Mir-142-v2  Hsa-Mir-142-v2  Mdo-Mir-142-v2  Mml-Mir-142-v2  Oan-Mir-142-v2  Ocu-Mir-142-v2  Rno-Mir-142-v2  Sha-Mir-142-v2  Sto-Mir-142-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr11: 87756867-87756925 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-v2)
Mir-142-v4 chr11: 87756865-87756927 [+] UCSC Ensembl
Mir-142-v1 chr11: 87756867-87756925 [+] UCSC Ensembl
Mir-142-v2 chr11: 87756867-87756925 [+] UCSC Ensembl
Mir-142-v3 chr11: 87756867-87756925 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCGUGGACAGACAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGCACUGUGGGCUUCGGAGACCACGC
Get precursor sequence
Structure
        10          20        30        40        50         
CCCCGUGGACAGACAGA--|      G   C           A         UAACAGCA 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        \
                   GUCACGU AGU GGUAUUUCAUC UUUGUGAUG        C
CGCACCAGAGGCUUCGGGU^      G   A           C         UGGGAGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-142-v2_5p*

MirBase accessionMIMAT0000154
Sequence
0- CAUAAAGUAGAAAGCACUACUA -22
Get sequence
Validated targets microrna.org: MIMAT0000154
TargetScanVert: mmu-miR-142a-5p
miRDB: MIMAT0000154
Mature sequence

Mmu-Mir-142-v2_3p

MirBase accessionMIMAT0000155
Sequence
37- GUAGUGUUUCCUACUUUAUGGA -59
Get sequence
Validated targets microrna.org: MIMAT0000155
TargetScanVert: mmu-miR-142a-3p.1
miRDB: MIMAT0000155