MirGeneDB

MirGeneDB ID

Mmu-Mir-140-v2

Family name MIR-140 (all species)
Seed ACCACAG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-140
Paralogues Mmu-Mir-140-v1 
Orthologues Aca-Mir-140-v2  Ami-Mir-140-v2  Bta-Mir-140-v2  Cfa-Mir-140-v2  Cli-Mir-140-v2  Cpi-Mir-140-v2  Cpo-Mir-140-v2  Dno-Mir-140-v2  Dre-Mir-140-v2  Ete-Mir-140-v2  Gga-Mir-140-v2  Hsa-Mir-140-v2  Mdo-Mir-140-v2  Mml-Mir-140-v2  Oan-Mir-140-v2  Ocu-Mir-140-v2  Rno-Mir-140-v2  Sha-Mir-140-v2  Sto-Mir-140-v2  Tgu-Mir-140-v2  Xtr-Mir-140-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr8: 107551249-107551310 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v2)
Mir-140-v1 chr8: 107551249-107551310 [+] UCSC Ensembl
Mir-140-v2 chr8: 107551249-107551310 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCCCUGUGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGGUACUGGAGCACCCUCUGCAUCGAAGG
Get precursor sequence
Structure
        10         20          30        40        50        60
CCGCCCUGUGUGUCUCU-    -  GU    -| A             A       UUACGU 
                  CUCU GU  CCUG CC GUGGUUUUACCCU UGGUAGG      C
                  GAGG CA  GGAC GG CACCAAGAUGGGA ACCAUCU      A
GGAAGCUACGUCUCCCAC    U  UG    A^ -             C       UGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-140-v2_5p*

MirBase accessionMIMAT0000151
Sequence
0- CAGUGGUUUUACCCUAUGGUAGG -23
Get sequence
Validated targets microrna.org: MIMAT0000151
TargetScanVert: mmu-miR-140-5p
miRDB: MIMAT0000151
Mature sequence

Mmu-Mir-140-v2_3p

MirBase accessionMIMAT0000152
Sequence
39- UACCACAGGGUAGAACCACGGAC -62
Get sequence
Validated targets microrna.org: MIMAT0000152
TargetScanVert: mmu-miR-140-3p.2
miRDB: MIMAT0000152