MirGeneDB

MirGeneDB ID

Mmu-Mir-103-P3

Family name MIR-103 (all species)
Seed GCAGCAU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-107
Paralogues Mmu-Mir-103-P1  Mmu-Mir-103-P2 
Orthologues Aca-Mir-103-P3  Bfl-Mir-103  Bta-Mir-103-P3  Cfa-Mir-103-P3  Cli-Mir-103-P3  Cpi-Mir-103-P3  Cpo-Mir-103-P3  Dno-Mir-103-P3  Dre-Mir-103-P3a  Dre-Mir-103-P3b  Ete-Mir-103-P3  Gga-Mir-103-P3  Hsa-Mir-103-P3  Mdo-Mir-103-P3  Mml-Mir-103-P3  Oan-Mir-103-P3  Ocu-Mir-103-P3  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P3  Sha-Mir-103-P3  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P3  Tgu-Mir-103-P3  Xtr-Mir-103-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(mm10)
chr19: 34820700-34820759 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAAUACUCGAUAUUUUUCUCUGUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGAGAGCUCGCGACAGCCAAGGCC
Get precursor sequence
Structure
        10          20        30          40        50         
GCAAUACUCGAUAUUUU--            C--|   U  U           C   UGGCA 
                   UCUCUGUGCUUU   AGCU CU UACAGUGUUGC UUG     U
                   AGAGACACGAAA   UCGG GA AUGUUACGACG AAC     G
CCGGAACCGACAGCGCUCG            CUA^   -  C           -   UUGAG 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-103-P3_5p*

MirBase accessionMIMAT0017048
Sequence
0- AGCUUCUUUACAGUGUUGCCUUG -23
Get sequence
Validated targets TargetScanVert: mmu-miR-107-5p
miRDB: MIMAT0017048
Mature sequence

Mmu-Mir-103-P3_3p

MirBase accessionMIMAT0000647
Sequence
37- AGCAGCAUUGUACAGGGCUAUCA -60
Get sequence
Validated targets microrna.org: MIMAT0000647
TargetScanVert: mmu-miR-107-3p
miRDB: MIMAT0000647