MirGeneDB

MirGeneDB ID

Mmu-Mir-10-P2a

Family name MIR-10 (all species)
Seed ACCCGUA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-100
Paralogues Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Mmu-Mir-10-P1b-v1  Mmu-Mir-10-P1b-v2  Mmu-Mir-10-P2b  Mmu-Mir-10-P2c  Mmu-Mir-10-P3a  Mmu-Mir-10-P3b  Mmu-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2a  Ami-Mir-10-P2a  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2a  Cfa-Mir-10-P2a  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cli-Mir-10-P2a  Cpi-Mir-10-P2a  Cpo-Mir-10-P2a  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2a  Dpu-Mir-10-P2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Ete-Mir-10-P2a  Gga-Mir-10-P2a  Hsa-Mir-10-P2a  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mdo-Mir-10-P2a  Mml-Mir-10-P2a  Oan-Mir-10-P2a  Ocu-Mir-10-P2a  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2a  Sha-Mir-10-P2a  Sko-Mir-10-P2  Sto-Mir-10-P2a  Tca-Mir-10-P2  Tgu-Mir-10-P2a3  Tgu-Mir-10-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(mm10)
chr9: 41531437-41531493 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P2a)
Mir-10-P2a chr9: 41531437-41531493 [+] UCSC Ensembl
Let-7-P1a chr9: 41536732-41536798 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAGAGAAGACACUGAAGCCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGCUGAUUCUGCACACAAGCUUGUGUCUAUAGGUAUGUGUCUGUUAGGCGAUCCCACAGUCCAGGGG
Get precursor sequence
Structure
        10         20         30        40        50        
CAAGAGAAGACACUGAA-     UUGC-|   A   CG    UC   A      CUGAU 
                  GCCUG     CACA ACC  UAGA  CGA CUUGUG     \
                  CGGAU     GUGU UGG  AUCU  GUU GAACAC     U
GGGGACCUGACACCCUAG     UGUCU^   A   AU    GU   C      ACGUC 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-10-P2a_5p

MirBase accessionMIMAT0000655
Sequence
0- AACCCGUAGAUCCGAACUUGUG -22
Get sequence
Validated targets microrna.org: MIMAT0000655
TargetScanVert: mmu-miR-100-5p
miRDB: MIMAT0000655
Star sequence

Mmu-Mir-10-P2a_3p*

MirBase accessionMIMAT0017051
Sequence
35- CAAGCUUGUGUCUAUAGGUAUG -57
Get sequence
Validated targets TargetScanVert: mmu-miR-100-3p
miRDB: MIMAT0017051