MirGeneDB

MirGeneDB ID

Mml-Mir-455

Family name MIR-455 (all species)
Seed AUGUGCC
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-455
Paralogues
Orthologues Aca-Mir-455  Ami-Mir-455  Bta-Mir-455  Cfa-Mir-455  Cli-Mir-455  Cpi-Mir-455  Cpo-Mir-455  Dno-Mir-455  Dre-Mir-455-P1  Dre-Mir-455-P2  Ete-Mir-455  Gga-Mir-455  Hsa-Mir-455  Mdo-Mir-455  Mmu-Mir-455  Oan-Mir-455  Ocu-Mir-455  Rno-Mir-455  Sha-Mir-455  Sto-Mir-455  Tgu-Mir-455  Xtr-Mir-455 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chr15: 25201157-25201214 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCGCCCGCGCCCUUCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUCGAGGAGC
Get precursor sequence
Structure
        10          20        30        40        50        
GAGCGCCCGCGCCCUUC-  -|  C UG  G          U      A   C UGGAA 
                  CC UGG G  AG GUAUGUGCCU UGGACU CAU G     G
                  GG ACU C  UC CAUAUACGGG ACCUGA GUA C     C
CGAGGAGCUACUGUAUCC  A^  C GU  A          U      C   C ACGAC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere are mutliple Dicer cuts on the 3p arm relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Mature sequence

Mml-Mir-455_5p

MirBase accessionMIMAT0006339
Sequence
0- UAUGUGCCUUUGGACUACAUCG -22
Get sequence
Validated targets TargetScanVert: mml-miR-455-5p
Star sequence

Mml-Mir-455_3p*

MirBase accessionMIMAT0006340
Sequence
36- AUGCAGUCCAUGGGCAUAUACA -58
Get sequence
Validated targets TargetScanVert: mml-miR-455-3p