MirGeneDB

MirGeneDB ID

Mml-Mir-27-P1

Family name MIR-27 (all species)
Seed UCACAGU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-27a
Paralogues Mml-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cfa-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mdo-Mir-27-P1  Mmu-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Sto-Mir-27-o1  Sto-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chr19: 13839020-13839081 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P1)
Mir-24-P1 chr19: 13838862-13838921 [-] UCSC Ensembl
Mir-27-P1 chr19: 13839020-13839081 [-] UCSC Ensembl
Mir-23-P1 chr19: 13839165-13839222 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCCGAAGCCUGUGCCUGGCCUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAGGCCCUCACCUCCUCCGGCCUUGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCCCCGAAGCCUGUGCCU--|     A  A  A         UG  U       GGGUCCAC 
                    GGCCUG GG GC GGGCUUAGC  CU GUGAGCA        \
                    CCGGAC CC CG CUUGAAUCG  GA CACUUGU        A
CGUUCCGGCCUCCUCCACUC^     C  C  C         GU  -       GCUGAACC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Star sequence

Mml-Mir-27-P1_5p*

MirBase accessionMIMAT0026600
Sequence
0- AGGGCUUAGCUGCUUGUGAGCA -22
Get sequence
Validated targets TargetScanVert: mml-miR-27a-5p
Mature sequence

Mml-Mir-27-P1_3p

MirBase accessionMIMAT0002753
Sequence
41- UUCACAGUGGCUAAGUUCCGC -62
Get sequence
Validated targets TargetScanVert: mml-miR-27a-3p