MirGeneDB

MirGeneDB ID

Mml-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-23a
Paralogues Mml-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chr19: 13839165-13839222 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-24-P1 chr19: 13838862-13838921 [-] UCSC Ensembl
Mir-27-P1 chr19: 13839020-13839081 [-] UCSC Ensembl
Mir-23-P1 chr19: 13839165-13839222 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCCCCCUCACCCCUGUGCCACGGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACCGACCCUGAGCUCUGCCACCGAGGAUGC
Get precursor sequence
Structure
        10         20        30         40        50        
GUCCCCCUCACCCCUGUGC-  C  C   C   -|        G    G     GCUUC 
                    CA GG CGG UGG GGUUCCUGG GAUG GAUUU     C
                    GU CC GCC ACC UUAGGGACC UUAC CUAAA     U
CGUAGGAGCCACCGUCUCGA  C  A   A   U^        G    A     CACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Star sequence

Mml-Mir-23-P1_5p*

MirBase accessionMIMAT0026599
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Validated targets TargetScanVert: mml-miR-23a-5p
Mature sequence

Mml-Mir-23-P1_3p

MirBase accessionMIMAT0002752
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence
Validated targets TargetScanVert: mml-miR-23a-3p