
MirGeneDB ID


Family name MIR-219 (all species)
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-219-1
Paralogues Mml-Mir-219-P2  Mml-Mir-219-P2-as 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
chr4: 34051842-34051905 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        60 
CCUCCCUUCCCCGCCCC---|   C       CU   U     A  G         AGUCUAU 
                    GGGC GCGGCUC  GAU GUCCA AC CAAUUCUCG       G
                    CCCG CGCCGAG  CUG CAGGU UG GUUGAGAGC       G
GAGAGGGGGAGCUCCAAACC^   C       CC   -     C  A         CGGUCUC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Star sequence


MirBase accessionMIMAT0002575
Get sequence
Validated targets TargetScanVert: mml-miR-219
Mature sequence


MirBase accessionNone
Get sequence