MirGeneDB

MirGeneDB ID

Mml-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chr1: 157131493-157131551 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAUCCUCAGGCAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACGACGAUGAGGCCU
Get precursor sequence
Structure
        10            20        30        40        50         
GAUCCUCAGGCAAUCCAU----|   UU      UC           C        UCUCAU 
                      GUGC  CUCUUG  CUUCAUUCCAC GGAGUCUG      \
                      UACG  GAGGAC  GAAGUGAGGUG CUUUAGAC      A
UCCGGAGUAGCAGCAGUCGAGG^   --      UU           A        CAACCC 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
CommentIn the primates and the dog the Dicer cut is shifted +1 relative to the other taxa.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Mature sequence

Mml-Mir-205-P1_5p

MirBase accessionMIMAT0006236
Sequence
0- UCCUUCAUUCCACCGGAGUCUGU -23
Get sequence
Validated targets TargetScanVert: mml-miR-205
Star sequence

Mml-Mir-205-P1_3p*

MirBase accessionNone
Sequence
38- AUUUCAGUGGAGUGAAGUUCA -59
Get sequence