MirGeneDB

MirGeneDB ID

Mml-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-19b-2
Paralogues Mml-Mir-19-P1  Mml-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rheMac8)
chrX: 128132038-128132103 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 128131737-128131801 [-] UCSC Ensembl
Mir-92-P1b chrX: 128131899-128131959 [-] UCSC Ensembl
Mir-19-P2b chrX: 128132038-128132103 [-] UCSC Ensembl
Mir-17-P3b chrX: 128132167-128132227 [-] UCSC Ensembl
Mir-17-P2b chrX: 128132397-128132461 [-] UCSC Ensembl
Mir-17-P1b chrX: 128132563-128132621 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAUAUUCAAAGACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGUGUGCUUCCUACAUCUGUG
Get precursor sequence
Structure
        10        20          30         40         50        60   
GAAUAUUCAAAGACAUUGCUAC--                 -  -|     UUU    GUAUAUAU 
                        UUACAAUUAGUUUUGCA GG UUUGCA   CAGC        \
                        AGUGUUAGUCAAAACGU CC AAACGU   GUCG        G
GUGUCUACAUCCUUCGUGUGUAAU                 A  U^     ---    GUGUAUAU 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Star sequence

Mml-Mir-19-P2b_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Mml-Mir-19-P2b_3p

MirBase accessionMIMAT0002705
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence
Validated targets TargetScanVert: mml-miR-19b