MirGeneDB

MirGeneDB ID

Mdo-Mir-27-P1

Family name MIR-27 (all species)
Seed UCACAGU
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-27a
Paralogues Mdo-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cfa-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mml-Mir-27-P1  Mmu-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Sto-Mir-27-o1  Sto-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
3: 446526008-446526070 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P1)
Mir-23-P1 3: 446525831-446525888 [+] UCSC Ensembl
Mir-27-P1 3: 446526008-446526070 [+] UCSC Ensembl
Mir-24-P1 3: 446526151-446526210 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCCCUCUUGCCCAGCCUGGCUUGAGGAGCAGGACUUAGCUGCCUUGUGAACAGAGUCAGCAUCAUAUUGUGUUCACAGUGGCUAAGUUCCGCUCCCCUUGCCCCCCUACCCUUGGCCACCUU
Get precursor sequence
Structure
        10          20        30        40        50        60  
GGCCCUCUUGCCCAGCCU--|  UUGA     A         UG CU        GAGUCAGC 
                    GGC    GGAGC GGACUUAGC  C  UGUGAACA        \
                    CCG    CCUCG CUUGAAUCG  G  ACACUUGU        A
UUCCACCGGUUCCCAUCCCC^  UUCC     C         GU --        GUUAUACU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-27-P1_5p*

MirBase accessionMIMAT0026711
Sequence
0- AGGACUUAGCUGCCUUGUGAACA -23
Get sequence
Validated targets TargetScanVert: mdo-miR-27a-5p
Mature sequence

Mdo-Mir-27-P1_3p

MirBase accessionMIMAT0004174
Sequence
42- UUCACAGUGGCUAAGUUCCGC -63
Get sequence
Validated targets TargetScanVert: mdo-miR-27a-3p