MirGeneDB

MirGeneDB ID

Mdo-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-23a
Paralogues Mdo-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
3: 446525831-446525888 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 3: 446525831-446525888 [+] UCSC Ensembl
Mir-27-P1 3: 446526008-446526070 [+] UCSC Ensembl
Mir-24-P1 3: 446526151-446526210 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGACCCAGUACCCCUGAGCCUUGGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGAUUACUGCCACAAAUCACAUUGCCAGGGAUUUCCAACUGACCACUGGCCCUGCUGCUGGAGCUGC
Get precursor sequence
Structure
        10        20         30         40        50        
GGACCCAGUACCCCUGAG  U-   C   C   -|        G    G     GAUUA 
                  CC  UGG CGG UGG GGUUCCUGG GAUG GAUUU     C
                  GG  ACC GUC ACC UUAGGGACC UUAC CUAAA     U
CGUCGAGGUCGUCGUCCC  UC   A   A   U^        G    A     CACCG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-23-P1_5p*

MirBase accessionMIMAT0026710
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Validated targets TargetScanVert: mdo-miR-23a-5p
Mature sequence

Mdo-Mir-23-P1_3p

MirBase accessionMIMAT0004173
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence
Validated targets TargetScanVert: mdo-miR-23a-3p