MirGeneDB

MirGeneDB ID

Mdo-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-219-2
Paralogues Mdo-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(monDom5)
2: 270698645-270698705 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCUCCGGCCCCGGCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGUGGCUCCGGCCCUCGAGAGUUGGGUCUGGACAUCCCGAGCCGCGGCCCCCACGCCUCGCAGAGGAGGG
Get precursor sequence
Structure
        10           20        30        40        50          
UCCUCCGGCCCCGGCCC---|           CU   U     A  G       CGUGGCUC 
                    GGGCCGCGGCUC  GAU GUCCA AC CAAUUCU        \
                    CCCGGCGCCGAG  CUA CAGGU UG GUUGAGA        C
GGGAGGAGACGCUCCGCACC^           CC   -     C  G       GCUCCCGG 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Mdo-Mir-219-P1_5p

MirBase accessionMIMAT0004134
Sequence
0- UGAUUGUCCAAACGCAAUUCU -21
Get sequence
Validated targets TargetScanVert: mdo-miR-219-5p
Star sequence

Mdo-Mir-219-P1_3p* (predicted)

MirBase accessionMIMAT0031109
Sequence
40- AGUUGGGUCUGGACAUCCCGA -61
Get sequence
Validated targets TargetScanVert: mdo-miR-219-2-3p