MirGeneDB

MirGeneDB ID

Mdo-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-19b-2
Paralogues Mdo-Mir-19-P1  Mdo-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
X: 35202389-35202447 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b X: 35202093-35202159 [-] UCSC Ensembl
Mir-92-P1b X: 35202231-35202295 [-] UCSC Ensembl
Mir-19-P2b X: 35202389-35202447 [-] UCSC Ensembl
Mir-17-P3b X: 35202543-35202603 [-] UCSC Ensembl
Mir-17-P2b X: 35202855-35202919 [-] UCSC Ensembl
Mir-17-P1b X: 35203052-35203108 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAGCUUUAAUCCCAGUGCUGCUCACAGUCAGUUUUGCAGGUCUUGCAUCGGCCUAUGUCAAUUGCUGUGCAAAUCCAUGCAAAACUGAUUAGGAGGGCAUUUGCAUCUGCACUUUUGG
Get precursor sequence
Structure
        10           20        30         40        50         
CUAGCUUUAAUCCCAGU---|  G   AC             -  UC     U    CUAUG 
                    GCU CUC  AGUCAGUUUUGCA GG  UUGCA CGGC     \
                    CGG GAG  UUAGUCAAAACGU CC  AACGU GUCG     U
GGUUUUCACGUCUACGUUUA^  -   GA             A  UA     -    UUAAC 
       110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-19-P2b_5p*

MirBase accessionMIMAT0031025
Sequence
0- AGUUUUGCAGGUCUUGCAUCGGC -23
Get sequence
Validated targets TargetScanVert: mdo-miR-19b-2-5p
Mature sequence

Mdo-Mir-19-P2b_3p

MirBase accessionMIMAT0004170
Sequence
36- UGUGCAAAUCCAUGCAAAACUGA -59
Get sequence
Validated targets TargetScanVert: mdo-miR-19b-3p