MirGeneDB

MirGeneDB ID

Mdo-Mir-130-P3a

Family name MIR-130 (all species)
Seed AGUGCAA
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-130c-1
Paralogues Mdo-Mir-130-P1a  Mdo-Mir-130-P1b  Mdo-Mir-130-P2a  Mdo-Mir-130-P4a 
Orthologues Aca-Mir-130-P3a  Ami-Mir-130-P3a  Cli-Mir-130-P3a  Cpi-Mir-130-P3a  Dre-Mir-130-P3a1  Gga-Mir-130-P3a  Oan-Mir-130-P3a  Sha-Mir-130-P3a  Sto-Mir-130-P3a  Tgu-Mir-130-P3a  Xtr-Mir-130-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
2: 172985794-172985856 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P3a)
Mir-130-P3a 2: 172985794-172985856 [+] UCSC Ensembl
Mir-130-P2a 2: 172986787-172986846 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCUUAUUGACUGAAUGGUAUUUGUCUAGUGCCCUUUUUAUGUUGUACUACUAGUGAUCCUGCACAAGAAGCAGUGCAAUGUUAAAAGGGCAUUGGCCAGUGAUACCAGUCACAUUUCUGGGC
Get precursor sequence
Structure
        10        20          30        40        50        60 
AUCUUAUUGACUGAAUGGUAU--|  U             U          A  AGUGAUCC 
                       UUG CUAGUGCCCUUUU AUGUUGUACU CU        \
                       GAC GGUUACGGGAAAA UGUAACGUGA GA        U
CGGGUCUUUACACUGACCAUAGU^  C             U          C  AGAACACG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-130-P3a_5p* (predicted)

MirBase accessionMIMAT0028514
Sequence
0- GCCCUUUUUAUGUUGUACUACU -22
Get sequence
Validated targets TargetScanVert: mdo-miR-130c-1-5p
Mature sequence

Mdo-Mir-130-P3a_3p

MirBase accessionMIMAT0028515
Sequence
41- CAGUGCAAUGUUAAAAGGGCAU -63
Get sequence
Validated targets TargetScanVert: mdo-miR-130c-3p