MirGeneDB

MirGeneDB ID

Mdo-Mir-10-P3a

Family name MIR-10 (all species)
Seed CCCUGAG
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-125b-2
Paralogues Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mdo-Mir-10-P1b-v1  Mdo-Mir-10-P1b-v2  Mdo-Mir-10-P2a  Mdo-Mir-10-P3c 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Ami-Mir-10-P3a  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Cfa-Mir-10-P3a  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cpi-Mir-10-P3a  Cpo-Mir-10-P3a  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Ete-Mir-10-P3a  Gga-Mir-10-P3a  Hsa-Mir-10-P3a  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mml-Mir-10-P3a  Mmu-Mir-10-P3a  Oan-Mir-10-P3a  Ocu-Mir-10-P3a  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Sha-Mir-10-P3a  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Xtr-Mir-10-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(monDom5)
4: 226229993-226230054 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAGGAAUGUUUGUUGCGCCCCUCUCAAUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGUGAGUUGUGCCUUUGCAUCUGGGAUAUUU
Get precursor sequence
Structure
        10          20        30         40        50        60
AGAAAGGAAUGUUUGUU--    CC   U  A-|   U    C           AUGUUUAC 
                   GCGC  CUC CA  UCCC GAGA CCUAACUUGUG        C
                   CGUG  GAG GU  AGGG UUCU GGAUUGGGCAC        G
UUUAUAGGGUCUACGUUUC    UU   U  CG^   -    C           CUAAAUUU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Mdo-Mir-10-P3a_5p

MirBase accessionMIMAT0004103
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Validated targets TargetScanVert: mdo-miR-125b-5p
Star sequence

Mdo-Mir-10-P3a_3p*

MirBase accessionMIMAT0031106
Sequence
40- ACGGGUUAGGCUCUUGGGAGCU -62
Get sequence
Validated targets TargetScanVert: mdo-miR-125b-2-3p