MirGeneDB

MirGeneDB ID

Lgi-Novel-3-P1

Family name LGI-NOVEL-3 (all species)
Seed CCACUCA
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues Lgi-Novel-3-P2 
Orthologues
Node of Origin (locus) L. gigantea
Node of Origin (family) L. gigantea
Genome context
(Lotgi1)
LOTGIsca_95: 478396-478454 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGUAACUGGGCUAAUAUUAGAGACCGGAAGUUGGAAGUUCACAUGGAUGUAGCCAUAUAGAACAGCUCCACUCAUGUGCACUUCCAGGUUUCUGGCUCGAAAAUCAACAAAGUGAGGAG
Get precursor sequence
Structure
        10          20         30        40        50         
CGUAACUGGGCUAAUAUUA--|  A     - G        U      GA  U   CAUAU 
                     GAG CCGGA A UUGGAAGU CACAUG  UG AGC     \
                     CUC GGUCU U GACCUUCA GUGUAC  AC UCG     A
GAGGAGUGAAACAACUAAAAG^  -     U G        C      UC  C   ACAAG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Novel-3-P1_5p*

MirBase accessionNone
Sequence
0- UUGGAAGUUCACAUGGAUGUAGC -23
Get sequence
Mature sequence

Lgi-Novel-3-P1_3p

MirBase accessionNone
Sequence
36- UCCACUCAUGUGCACUUCCAGGU -59
Get sequence