MirGeneDB

MirGeneDB ID

Lgi-Mir-96-P1b

Family name MIR-96 (all species)
Seed UUUGGCA
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-96b
Paralogues Lgi-Mir-96-P1a  Lgi-Mir-96-P2  Lgi-Mir-96-P3 
Orthologues Ami-Mir-96-P1  Bfl-Mir-96-P1  Bta-Mir-96-P1  Cfa-Mir-96-P1  Cgi-Mir-96-P1b  Cin-Mir-96-P1  Cli-Mir-96-P1  Cpi-Mir-96-P1  Cpo-Mir-96-P1  Cte-Mir-96-P1  Dno-Mir-96-P1  Dre-Mir-96-P1  Efe-Mir-96-P1  Ete-Mir-96-P1  Gga-Mir-96-P1  Hsa-Mir-96-P1  Isc-Mir-96-P1  Lan-Mir-96-P1  Mdo-Mir-96-P1  Mml-Mir-96-P1  Mmu-Mir-96-P1  Oan-Mir-96-P1  Ocu-Mir-96-P1  Pfl-Mir-96-P1  Pmi-Mir-96-P1  Rno-Mir-96-P1  Sha-Mir-96-P1  Sko-Mir-96-P1  Spu-Mir-96-P1  Sto-Mir-96-P1  Tgu-Mir-96-P1  Xtr-Mir-96-P1 
Node of Origin (locus) Mollusca
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_112: 69886-69944 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUUGGUUUUCACUAUAAUGCGUAUGCAAUUAUUUGGCACUUGUGGAAUAAUCGGUAUAAAUAACAAGAUUAUACACCGGUGCCAAAUAACCGGUGGCGCUAAAUCAUCUAUACCAGAAG
Get precursor sequence
Structure
        10          20         30        40        50         
AUUGGUUUUCACUAUAAU--|   A   AA-            U   GA      GGUAUA 
                    GCGU UGC   UUAUUUGGCACU GUG  AUAAUC      A
                    CGCG GUG   AAUAAACCGUGG CAC  UAUUAG      A
GAAGACCAUAUCUACUAAAU^   -   GCC            C   A-      AACAAU 
       110       100         90        80         70        60
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-96-P1b_5p (predicted)

MirBase accessionMIMAT0009576
Sequence
0- AUUUGGCACUUGUGGAAUAAUCG -23
Get sequence
Star sequence

Lgi-Mir-96-P1b_3p* (predicted)

MirBase accessionNone
Sequence
37- AUUAUACACCGGUGCCAAAUAA -59
Get sequence