MirGeneDB

MirGeneDB ID

Lgi-Mir-92-o29

Family name MIR-92 (all species)
Seed AUUGCAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-92
Paralogues Lgi-Mir-92-o27-v1  Lgi-Mir-92-o27-v2  Lgi-Mir-92-o28  Lgi-Mir-92-o30 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_47: 43249-43304 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o29)
Mir-92-o28 LOTGIsca_47: 43039-43096 [-] Ensembl
Mir-92-o29 LOTGIsca_47: 43249-43304 [-] Ensembl
Mir-92-o27-v1 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o27-v2 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o30 LOTGIsca_47: 46552-46607 [-] Ensembl
Mir-190-v1 LOTGIsca_47: 52951-53013 [-] Ensembl
Mir-190-v2 LOTGIsca_47: 52951-53012 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUGUAUAAUUAUAAUCUUGACUUGUAGGCUGGAACUUGGGGCAACUAUGGUUUGACUUGGUCCAAUUGCACUUGUCCCGGCCUGCUUGUUUUGAUUCUUCACAACUGUAAGAUUG
Get precursor sequence
Structure
        10              20        30        40        50       
GAUGUAUAAUUAUAAUCUU------|  UU         A  UU  G    CUA   UUUGA 
                         GAC  GUAGGCUGG AC  GG GCAA   UGG     \
                         UUG  CGUCCGGCC UG  UC CGUU   ACC     C
GUUAGAAUGUCAACACUUCUUAGUU^  UU         C  U-  A    A--   UGGUU 
    110       100        90        80         70          60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-92-o29_5p* (predicted)

MirBase accessionNone
Sequence
0- UGGAACUUGGGGCAACUAUGGUUUG -25
Get sequence
Mature sequence

Lgi-Mir-92-o29_3p

MirBase accessionMIMAT0009574
Sequence
34- AAUUGCACUUGUCCCGGCCUGC -56
Get sequence