MirGeneDB

MirGeneDB ID

Lgi-Mir-92-o27-v1

Family name MIR-92 (all species)
Seed AUUGCAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-92
Paralogues Lgi-Mir-92-o27-v2  Lgi-Mir-92-o28  Lgi-Mir-92-o29  Lgi-Mir-92-o30 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_47: 43373-43430 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o27-v1)
Mir-92-o28 LOTGIsca_47: 43039-43096 [-] Ensembl
Mir-92-o29 LOTGIsca_47: 43249-43304 [-] Ensembl
Mir-92-o27-v1 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o27-v2 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o30 LOTGIsca_47: 46552-46607 [-] Ensembl
Mir-190-v1 LOTGIsca_47: 52951-53013 [-] Ensembl
Mir-190-v2 LOTGIsca_47: 52951-53012 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUAUUUCAUAAUGAAGAAAGAUGAGUUGCAGGUCGUGAUAUUUGCAAUAUGGAGAAGAAUAAUCAAAUUGCACUUGUCCCGGCCUGCUGCAAAGUCUUCACCUCAACUAAAUAGUAU
Get precursor sequence
Structure
        10         20         30        40        50        
UUUAUUUCAUAAUGAAGA-     GA-| U        U    UU      A  GAGAA 
                   AAGAU   GU GCAGGUCG GAUA  UGCAAU UG     G
                   UUCUG   CG CGUCCGGC CUGU  ACGUUA AC     A
UAUGAUAAAUCAACUCCAC     AAA^ U        C    UC      A  UAAUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-92-o27-v1_5p* (predicted)

MirBase accessionNone
Sequence
0- AGGUCGUGAUAUUUGCAAUAUG -22
Get sequence
Mature sequence

Lgi-Mir-92-o27-v1_3p

MirBase accessionMIMAT0009574
Sequence
36- AAUUGCACUUGUCCCGGCCUGC -58
Get sequence