MirGeneDB

MirGeneDB ID

Lgi-Mir-87

Family name MIR-87 (all species)
Seed UGAGCAA
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-87
Paralogues
Orthologues Aae-Mir-87  Asu-Mir-87-o20  Asu-Mir-87-o21  Bge-Mir-87-o22  Bge-Mir-87-o23  Bge-Mir-87-o24  Cbr-Mir-87-o5  Cbr-Mir-87-o6  Cel-Mir-87-o5  Cel-Mir-87-o6  Cgi-Mir-87-o7  Cgi-Mir-87-o8  Cte-Mir-87-o9  Cte-Mir-87-o10  Dan-Mir-87-v1  Dan-Mir-87-v2  Dme-Mir-87-v1  Dme-Mir-87-v2  Dmo-Mir-87-v1  Dmo-Mir-87-v2  Dpu-Mir-87-o1  Dpu-Mir-87-o2  Efe-Mir-87-o11  Efe-Mir-87-o12  Efe-Mir-87-o13  Efe-Mir-87-o14  Efe-Mir-87-o15  Efe-Mir-87-o16  Efe-Mir-87-o17  Hme-Mir-87  Isc-Mir-87-o3  Isc-Mir-87-o4  Lan-Mir-87-o25  Lan-Mir-87-o26  Tca-Mir-87-o18  Tca-Mir-87-o19 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_160: 256830-256887 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUUUGAUUAAUAACUUGAGGUUUGUCUGAGGUGCCUGAAAUUUUAGCUCAAACCUAAUAAUAGAAGGUGAGCAAAGUUUCAGGUGUAUCAGCUGAACUUAUAUAUCUUCUUUACUCUG
Get precursor sequence
Structure
        10          20        30        40        50          
GUUUGAUUAAUAACUUG--|      U    G UG           A    AA    AAUA 
                   AGGUUUG CUGA G  CCUGAAAUUUU GCUC  ACCU    \
                   UUCAAGU GACU U  GGACUUUGAAA CGAG  UGGA    A
GUCUCAUUUCUUCUAUAUA^      C    A GU           -    --    AGAU 
      110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-87_5p* (predicted)

MirBase accessionNone
Sequence
0- GUGCCUGAAAUUUUAGCUCAAACCU -25
Get sequence
Mature sequence

Lgi-Mir-87_3p

MirBase accessionMIMAT0009573
Sequence
36- GUGAGCAAAGUUUCAGGUGUAU -58
Get sequence