MirGeneDB

MirGeneDB ID

Lgi-Mir-2-o26

Family name MIR-2 (all species)
Seed AUCACAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-2c
Paralogues Lgi-Mir-2-o14  Lgi-Mir-2-o27a  Lgi-Mir-2-o27b 
Orthologues
Node of Origin (locus) L. gigantea
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_2: 5780837-5780893 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAAUGGACAUUACCGGUAUUUAUGGAGAUCCCAUUAAAGUGGUUGUGAUGUGUUAAAUUCAUCAUAUCACAGCCAGCUUUGAUGAGUUCUUUAUAAACAAAAUCAGCUAAGAAAUGC
Get precursor sequence
Structure
        10          20        30         40        50       
CAAUGGACAUUACCGGUA--          UCC        -|            UUAA 
                    UUUAUGGAGA   CAUUAAAG UGGUUGUGAUGUG    A
                    AAAUAUUUCU   GUAGUUUC ACCGACACUAUAC    U
CGUAAAGAAUCGACUAAAAC          UGA        G^            UACU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-2-o26_5p*

MirBase accessionNone
Sequence
0- CCAUUAAAGUGGUUGUGAUGUG -22
Get sequence
Mature sequence

Lgi-Mir-2-o26_3p

MirBase accessionMIMAT0009558
Sequence
34- UAUCACAGCCAGCUUUGAUGAGU -57
Get sequence