MirGeneDB

MirGeneDB ID

Lgi-Mir-2-o14

Family name MIR-2 (all species)
Seed AUCACAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-2d
Paralogues Lgi-Mir-2-o26  Lgi-Mir-2-o27a  Lgi-Mir-2-o27b 
Orthologues
Node of Origin (locus) L. gigantea
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_2: 4520084-4520140 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o14)
Mir-2-o27a LOTGIsca_2: 4514963-4515021 [-] Ensembl
Mir-2-o27b LOTGIsca_2: 4515158-4515216 [-] Ensembl
Mir-71 LOTGIsca_2: 4515804-4515862 [-] Ensembl
Mir-2-o14 LOTGIsca_2: 4520084-4520140 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGUAUCUGAAAGUAUUUUGUCCCUGCUCUGACCAAGUGGCUGAGAUAAGUUUAUUUGAAUCUUAUCACAGCCUGCUUGGAUCAGUUCAGUGUCAAAUAUAAACAACAAAAUAGGA
Get precursor sequence
Structure
        10          20        30          40        50       
AGUGUAUCUGAAAGUAU--    UCC   CU    -      -|    A      UUUAU 
                   UUUG   CUG  CUGA CCAAGU GGCUG GAUAAG     \
                   AAAC   GAC  GACU GGUUCG CCGAC CUAUUC     U
AGGAUAAAACAACAAAUAU    UGU   UU    A      U^    A      UAAGU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-2-o14_5p* (predicted)

MirBase accessionNone
Sequence
0- UGACCAAGUGGCUGAGAUAAG -21
Get sequence
Mature sequence

Lgi-Mir-2-o14_3p

MirBase accessionMIMAT0009559
Sequence
34- UAUCACAGCCUGCUUGGAUCAGU -57
Get sequence