MirGeneDB

MirGeneDB ID

Lgi-Mir-1990

Family name MIR-1990 (all species)
Seed GUAAGUU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1990
Paralogues
Orthologues Cgi-Mir-1990  Cte-Mir-1990-P1  Cte-Mir-1990-P2  Efe-Mir-1990-P1  Efe-Mir-1990-P2  Efe-Mir-1990-P3  Lan-Mir-1990 
Node of Origin (locus) Lophotrochozoa
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_39: 82026-82079 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1990)
Mir-1986 LOTGIsca_39: 81755-81811 [-] Ensembl
Mir-1990 LOTGIsca_39: 82026-82079 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCAGAAAUUAAUGACGUCACUAUUCGUGCAGUAAGUUGAUGGGGUCCCAGGUUAUUUUGUCCCGGGACUACGUCAACUACUAGCACGCGCAGUGACAGAACAACAUCAAAAUG
Get precursor sequence
Structure
        10         20        30         40        50       
CGCAGAAAUUAAUGACG-     AUU     -|   A       GG     A  UUAU 
                  UCACU   CGUGC AGUA GUUGAUG  GUCCC GG    \
                  AGUGA   GCACG UCAU CAACUGC  CAGGG CC    U
GUAAAACUACAACAAGAC     CGC     A^   -       AU     C  UGUU 
  110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-1990_5p (predicted)

MirBase accessionMIMAT0009732
Sequence
0- AGUAAGUUGAUGGGGUCCCAGG -22
Get sequence
Star sequence

Lgi-Mir-1990_3p* (predicted)

MirBase accessionNone
Sequence
33- CGGGACUACGUCAACUACUAG -54
Get sequence