MirGeneDB

MirGeneDB ID

Lgi-Mir-124-P10

Family name MIR-124 (all species)
Seed AAGGCAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-124
Paralogues Lgi-Mir-124-P11 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_15: 2554528-2554585 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUUCUUAAUCCAAAAUGGCGGAUCUGUUAGUGUUCACUGUGAAAGCCUUGGUGUAAUUAAAACUAUUAAGGCACGCGGUGAAUGCCAAUAGGUCGUCAAUAUCUUCUUAAAGAAGCU
Get precursor sequence
Structure
        10           20        30        40        50         
CAUUCUUAAUCCAAAAU---|   G       A            AAA        GUAAU 
                    GGCG AUCUGUU GUGUUCACUGUG   GCCUUGGU     U
                    CUGC UGGAUAA CGUAAGUGGCGC   CGGAAUUA     A
UCGAAGAAAUUCUUCUAUAA^   -       C            A--        UCAAA 
      110       100         90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-124-P10_5p* (predicted)

MirBase accessionNone
Sequence
0- GUGUUCACUGUGAAAGCCUUGGU -23
Get sequence
Mature sequence

Lgi-Mir-124-P10_3p

MirBase accessionMIMAT0009578
Sequence
37- UAAGGCACGCGGUGAAUGCCA -58
Get sequence