
MirGeneDB ID


Family name MIR-2001 (all species)
Species Lingula (Lingula anatina)
MiRBase ID
Paralogues Lan-Mir-2001-P1 
Orthologues Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) L. anatina
Node of Origin (family) Bilateria
Genome context
LFEI01000195: 453230-453288 [-] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30         40        50         
ACAACAAAAACAGUACC---|   A    G   -      C        U     UGGACAU 
                    CAUG UCUG UCG UUGUGA CGUUAUAA GGGCA       \
                    GUAC AGAC AGC AAUACU GCAAUAUU CUCGU       A
AGACUCCAGCUACACAGUCU^   -    -   C      C        U     AACAAGU 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
To To
Mature sequence

Lan-Mir-2001-P2_5p (predicted)

MirBase accessionNone
Get sequence
Star sequence

Lan-Mir-2001-P2_3p* (predicted)

MirBase accessionNone
Get sequence