MirGeneDB

MirGeneDB ID

Lan-Mir-2-o73

Family name MIR-2 (all species)
Seed AUCACAG
Species Lingula (Lingula anatina)
MiRBase ID
Paralogues Lan-Mir-2-o71  Lan-Mir-2-o72a  Lan-Mir-2-o72b  Lan-Mir-2-o74  Lan-Mir-2-o75  Lan-Mir-2-o76  Lan-Mir-2-o77a  Lan-Mir-2-o77b  Lan-Mir-2-o78  Lan-Mir-2-o79 
Orthologues
Node of Origin (locus) L. anatina
Node of Origin (family) Protostomia
Genome context
(LinAna_1.0)
LFEI01000222: 414455-414514 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGAGAGGCAGAAAGUGCAUCUCUCCCCACCAUUAAAGUGGCUGUGAUGUGUUGAUUGUAUACUCAUAUCACAGCCUGCUUUGAUGAGAGGGAGUGACAACGCCACAUCUGAUGUUCUA
Get precursor sequence
Structure
        10        20          30        40         50         
GAGGAGAGGCAGAAAGUGCA--  U     CAC         -|           UUGAUU 
                      UC CUCCC   CAUUAAAGU GGCUGUGAUGUG      \
                      AG GAGGG   GUAGUUUCG CCGACACUAUAC      G
AUCUUGUAGUCUACACCGCAAC  U     AGA         U^           UCAUAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-2-o73_5p* (predicted)

MirBase accessionNone
Sequence
0- CCAUUAAAGUGGCUGUGAUGUG -22
Get sequence
Mature sequence

Lan-Mir-2-o73_3p

MirBase accessionNone
Sequence
37- UAUCACAGCCUGCUUUGAUGAGA -60
Get sequence