MirGeneDB

MirGeneDB ID

Isc-Mir-87-o4

Family name MIR-87 (all species)
Seed UGCCCGG
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues Isc-Mir-87-o3 
Orthologues Aae-Mir-87  Hme-Mir-87  Lgi-Mir-87 
Node of Origin (locus) Ixodes
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS929532: 41909-41969 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAACCGUCUCCGUCUGGGUGACUCUGAUGUGCCCGGAACUUUGUCUCAGCCUGGACUGUUAGCGCAGGUGAGCAAAGUUUCAGGUGUGUUGCAGUCACUCCAACUCACCAGUGGAUCGU
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUCAACCGUCUCCGUCU-  -|     C     UG  C         U    G   GGACUG 
                  GG GUGACU UGAUG  CC GGAACUUUG CUCA CCU      \
                  CC CACUGA GUUGU  GG CUUUGAAAC GAGU GGA      U
UGCUAGGUGACCACUCAA  U^     C     GU  A         -    -   CGCGAU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-87 genes were present in the last common ancestor of protostomes and thus these multiple paralogues are classified here as orphans pending additional data.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-87-o4_5p

MirBase accessionNone
Sequence
0- GUGCCCGGAACUUUGUCUCAGCCU -24
Get sequence
Star sequence

Isc-Mir-87-o4_3p*

MirBase accessionNone
Sequence
39- GUGAGCAAAGUUUCAGGUGUGU -61
Get sequence