MirGeneDB

MirGeneDB ID

Isc-Mir-252-P1-v2

Family name MIR-252 (all species)
Seed AAGUACU
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues Isc-Mir-252-P1-v1  Isc-Mir-252-P2 
Orthologues Aae-Mir-252-P1  Bfl-Mir-252-P1  Bge-Mir-252-P1-v1  Bge-Mir-252-P1-v2  Cbr-Mir-252-P1  Cel-Mir-252-P1  Cgi-Mir-252-P1  Cte-Mir-252-P1  Dan-Mir-252-P1-v1  Dan-Mir-252-P1-v2  Dme-Mir-252-P1-v1  Dme-Mir-252-P1-v2  Dmo-Mir-252-P1-v1  Dmo-Mir-252-P1-v2  Dpu-Mir-252-P1-v1  Dpu-Mir-252-P1-v2  Hme-Mir-252-P1  Lan-Mir-252-P1a  Lan-Mir-252-P1b  Lgi-Mir-252-P1  Pfl-Mir-252-P1  Pmi-Mir-252-P1  Sko-Mir-252-P1  Spu-Mir-252-P1  Tca-Mir-252-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS858616: 253418-253477 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUGUCUCCGGCCGUGUGACACUCCGGGCUAAGUACUAGCGCCGUAGGAGUGGGGUUUUUGGACACUCCCCCACGCCUUGGUGUUUCCCGAGGGCGUUAAUGUUGUGCCUUUAACCCCG
Get precursor sequence
Structure
        10           20         30        40          50         
AGAUGUCUCCGGCCGUG---    A   -|   CU         C  C  A--     GGGGUU 
                    UGAC CUC CGGG  AAGUACUAG GC GU   GGAGU      \
                    AUUG GGG GCCC  UUUGUGGUU CG CA   CCUCA      U
GCCCCAAUUUCCGUGUUGUA    C   A^   --         C  -  CCC     CAGGUU 
.       110       100        90          80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-252-P1-v2_5p

MirBase accessionNone
Sequence
0- UAAGUACUAGCGCCGUAGGAGU -22
Get sequence
Star sequence

Isc-Mir-252-P1-v2_3p* (predicted)

MirBase accessionNone
Sequence
38- CCCCCACGCCUUGGUGUUUCCC -60
Get sequence