MirGeneDB

MirGeneDB ID

Isc-Mir-2-o8

Family name MIR-2 (all species)
Seed AUCACAG
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-2b
Paralogues Isc-Mir-2-o7  Isc-Mir-2-o9 
Orthologues Aae-Mir-2-P8  Dan-Mir-2-P8  Dme-Mir-2-P8  Dmo-Mir-2-P8  Hme-Mir-2-P8  Tca-Mir-2-P8 
Node of Origin (locus) Ixodes
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS799611: 45565-45627 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o8)
Mir-2-o7 DS799611: 45175-45234 [-] Ensembl
Mir-2-o8 DS799611: 45565-45627 [-] Ensembl
Mir-71 DS799611: 45706-45768 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AACGGCCAGGCUAAUGUUUUCCUGUGCAGCCGUCAAAGGGACUGUGAAAUGUCUCCCUUCUUGGUCAGCAUAUCACAGCCACCUUUGAUGAGCUGUACACGAAUCGGACUCCUUCGAGGUGCA
Get precursor sequence
Structure
        10          20        30         40         50          
AACGGCCAGGCUAAUGUU--   C        -         GA-|     A   UCUCCCUU 
                    UUC UGUGCAGC CGUCAAAGG   CUGUGA AUG        \
                    AAG ACAUGUCG GUAGUUUCC   GACACU UAC        C
ACGUGGAGCUUCCUCAGGCU   C        A         ACC^     A   GACUGGUU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-2-o8_5p*

MirBase accessionNone
Sequence
0- CGUCAAAGGGACUGUGAAAUG -21
Get sequence
Mature sequence

Isc-Mir-2-o8_3p

MirBase accessionMIMAT0012697
Sequence
40- UAUCACAGCCACCUUUGAUGAGC -63
Get sequence