MirGeneDB

MirGeneDB ID

Hsa-Mir-642-as

Family name MIR-642 (all species)
Seed UCCCUCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-642b
Paralogues Hsa-Mir-642 
Orthologues Mml-Mir-642 
Node of Origin (locus) H. sapiens
Node of Origin (family) Catarrhini
Genome context
(hg38)
chr19: 45674941-45674997 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-642-as)
Mir-642-as chr19: 45674941-45674997 [-] UCSC Ensembl
Mir-642 chr19: 45674943-45674999 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAAUGAUGGCAGAGGCCGAGUUGGGAGGUUCCCUCUCCAAAUGUGUCUUGAUCCCCCACCCCAAGACACAUUUGGAGAGGGACCCUCCCAACUCAGAUAAACUGUGGAGAGUGUA
Get precursor sequence
Structure
        10          20        30        40        50        
UUAAAUGAUGGCAGAGGCC--|          U                     AUCCC 
                     GAGUUGGGAGG UCCCUCUCCAAAUGUGUCUUG     \
                     CUCAACCCUCC AGGGAGAGGUUUACACAGAAC     C
AUGUGAGAGGUGUCAAAUAGA^          C                     CCCAC 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-642-as_5p

MirBase accessionMIMAT0022736
Sequence
0- UUCCCUCUCCAAAUGUGUCUUG -22
Get sequence
Validated targets TargetScanVert: hsa-miR-642b-5p
TargetMiner: hsa-miR-642b-5p
miRDB: MIMAT0022736
Star sequence

Hsa-Mir-642-as_3p*

MirBase accessionMIMAT0018444
Sequence
35- AGACACAUUUGGAGAGGGACCC -57
Get sequence
Validated targets TargetScanVert: hsa-miR-642b-3p
TargetMiner: hsa-miR-642b-3p
miRDB: MIMAT0018444