MirGeneDB

MirGeneDB ID

Hsa-Mir-34-P3a

Family name MIR-34 (all species)
Seed GGCAGUG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-449a
Paralogues Hsa-Mir-34-P1  Hsa-Mir-34-P2a  Hsa-Mir-34-P2b  Hsa-Mir-34-P3b  Hsa-Mir-34-P3c 
Orthologues Aae-Mir-34  Aca-Mir-34-P3a  Ami-Mir-34-P3a  Asu-Mir-34  Bge-Mir-34  Bta-Mir-34-P3a  Cbr-Mir-34  Cel-Mir-34  Cfa-Mir-34-P3a  Cgi-Mir-34  Cin-Mir-34  Cli-Mir-34-P3a  Cpi-Mir-34-P3a  Cpo-Mir-34-P3a  Cte-Mir-34  Dan-Mir-34  Dme-Mir-34  Dmo-Mir-34  Dno-Mir-34-P3a  Dpu-Mir-34  Efe-Mir-34  Ete-Mir-34-P3a  Gga-Mir-34-P3a  Lgi-Mir-34  Mdo-Mir-34-P3a  Mml-Mir-34-P3a  Mmu-Mir-34-P3a  Oan-Mir-34-P3a  Ocu-Mir-34-P3a  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P3a  Sha-Mir-34-P3a  Sko-Mir-34  Spu-Mir-34  Sto-Mir-34-P3a  Tca-Mir-34  Tgu-Mir-34-P3a  Xtr-Mir-34-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr5: 55170546-55170607 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-34-P3a)
Mir-34-P3a chr5: 55170546-55170607 [-] UCSC Ensembl
Mir-34-P3b chr5: 55170668-55170727 [-] UCSC Ensembl
Mir-34-P3c chr5: 55172279-55172336 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUGCUCUGGAUACCUGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACAAUGAACAUCAGAGUGU
Get precursor sequence
Structure
        10          20        30         40        50        60
AAGUGCUCUGGAUACCU--     UG     C      -|    U          UGAAUAU 
                   GUGUG  AUGAG UGGCAG UGUAU GUUAGCUGGU       G
                   UAUAC  UAUUC GUCGUC ACGUA CAAUCGGCUA       U
UGUGAGACUACAAGUAACA     GU     U      A^    -          CGGUAAG 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-34-P3a_5p

MirBase accessionMIMAT0001541
Sequence
0- UGGCAGUGUAUUGUUAGCUGGU -22
Get sequence
Validated targets microrna.org: MIMAT0001541
TargetScanVert: hsa-miR-449a
TargetMiner: hsa-miR-449a
miRDB: MIMAT0001541
Star sequence

Hsa-Mir-34-P3a_3p*

MirBase accessionNone
Sequence
40- CGGCUAACAUGCAACUGCUGUC -62
Get sequence