MirGeneDB

MirGeneDB ID

Hsa-Mir-33-P2

Family name MIR-33 (all species)
Seed AGUGCCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-33b
Paralogues Hsa-Mir-33-P1 
Orthologues Aae-Mir-33  Aca-Mir-33-P2  Ami-Mir-33-P2  Bge-Mir-33  Bta-Mir-33-P2  Cfa-Mir-33-P2  Cgi-Mir-33  Cin-Mir-33  Cli-Mir-33-P2  Cpi-Mir-33-P2  Cpo-Mir-33-P2  Cte-Mir-33  Dan-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dno-Mir-33-P2  Dpu-Mir-33  Dre-Mir-33-P2  Efe-Mir-33  Ete-Mir-33-P2  Gga-Mir-33-P2  Isc-Mir-33  Lgi-Mir-33  Mml-Mir-33-P2  Oan-Mir-33-P2  Ocu-Mir-33-P2  Pfl-Mir-33  Pmi-Mir-33  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P2  Tca-Mir-33  Xtr-Mir-33-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr17: 17813858-17813916 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGGGGCCGAGAGAGGCGGGCGGCCCCGCGGUGCAUUGCUGUUGCAUUGCACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGGAGCCGGCCCCUGGCACCACGGGCCCCC
Get precursor sequence
Structure
        10         20         30         40        50         
UGGGGGCCGAGAGAGGC-   -|   C   C  -          UU        CGUGUGU 
                  GGG CGGC CCG GG UGCAUUGCUG  GCAUUGCA       \
                  CCC GCCG GGC CC ACGUGACGGC  CGUGACGU       G
CCCCCGGGCACCACGGUC   G^   A   -  G          UC        GGGCGGA 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-33-P2_5p*

MirBase accessionMIMAT0003301
Sequence
0- GUGCAUUGCUGUUGCAUUGCA -21
Get sequence
Validated targets microrna.org: MIMAT0003301
TargetScanVert: hsa-miR-33b-5p
TargetMiner: hsa-miR-33b-5p
miRDB: MIMAT0003301
Mature sequence

Hsa-Mir-33-P2_3p

MirBase accessionMIMAT0004811
Sequence
38- CAGUGCCUCGGCAGUGCAGCC -59
Get sequence
Validated targets microrna.org: MIMAT0004811
TargetScanVert: hsa-miR-33b-3p
TargetMiner: hsa-miR-33b-3p
miRDB: MIMAT0004811