MirGeneDB

MirGeneDB ID

Hsa-Mir-30-P2c

Family name MIR-30 (all species)
Seed GUAAACA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-30b
Paralogues Hsa-Mir-30-P1a  Hsa-Mir-30-P1b  Hsa-Mir-30-P1c  Hsa-Mir-30-P2a  Hsa-Mir-30-P2b 
Orthologues Aca-Mir-30-P2c  Ami-Mir-30-P2c  Bta-Mir-30-P2c  Cfa-Mir-30-P2c  Cpi-Mir-30-P2c  Cpo-Mir-30-P2c  Dno-Mir-30-P2c  Dre-Mir-30-P2c  Ete-Mir-30-P2c  Gga-Mir-30-P2c  Mdo-Mir-30-P2c  Mml-Mir-30-P2c  Mmu-Mir-30-P2c  Oan-Mir-30-P2c  Ocu-Mir-30-P2c  Rno-Mir-30-P2c  Sha-Mir-30-P2c  Sto-Mir-30-P2c  Tgu-Mir-30-P2c  Xtr-Mir-30-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr8: 134800532-134800591 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P2c)
Mir-30-P2c chr8: 134800532-134800591 [-] UCSC Ensembl
Mir-30-P1c chr8: 134804879-134804940 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUCCUGCUUUAAACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGAAUGUCAACCAAUUAACAU
Get precursor sequence
Structure
        10            20        30        40         50         
AAGUCCUGCUUUAAACC----|  UU      CAU          U  A-       GUAAUA 
                     AAG  UCAGUU   GUAAACAUCC AC  CUCAGCU      C
                     UUC  AGUCGA   CAUUUGUAGG UG  GGGUCGG      A
UACAAUUAACCAACUGUAAGG^  --      CUU          -  GA       UUAGGU 
.       110       100          90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-30-P2c_5p

MirBase accessionMIMAT0000420
Sequence
0- UGUAAACAUCCUACACUCAGCU -22
Get sequence
Validated targets microrna.org: MIMAT0000420
TargetScanVert: hsa-miR-30b-5p
TargetMiner: hsa-miR-30b-5p
miRDB: MIMAT0000420
Star sequence

Hsa-Mir-30-P2c_3p*

MirBase accessionMIMAT0004589
Sequence
38- CUGGGAGGUGGAUGUUUACUUC -60
Get sequence
Validated targets microrna.org: MIMAT0004589
TargetScanVert: hsa-miR-30b-3p
TargetMiner: hsa-miR-30b-3p
miRDB: MIMAT0004589