MirGeneDB

MirGeneDB ID

Hsa-Mir-219-P1

Family name MIR-219 (all species)
Seed GAGUUGA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-219a-1
Paralogues Hsa-Mir-219-P2  Hsa-Mir-219-P2-as 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr6: 33207855-33207918 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCCUUCCCCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUAUGGCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGCCGCCCCCAAACCUCGAGCGGGAGAG
Get precursor sequence
Structure
        10           20        30        40        50        60 
CCUCCCUUCCCCGCCCC---|   C       CU   U     A  G         AGUCUAU 
                    GGGC GCGGCUC  GAU GUCCA AC CAAUUCUCG       G
                    CCCG CGCCGAG  CUG CAGGU UG GUUGAGAGC       G
GAGAGGGCGAGCUCCAAACC^   C       CC   -     C  A         CGGCCUC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-219-P1_5p*

MirBase accessionMIMAT0000276
Sequence
0- UGAUUGUCCAAACGCAAUUCUCG -23
Get sequence
Validated targets microrna.org: MIMAT0000276
TargetScanVert: hsa-miR-219a-5p
miRDB: MIMAT0000276
Mature sequence

Hsa-Mir-219-P1_3p

MirBase accessionMIMAT0004567
Sequence
41- AGAGUUGAGUCUGGACGUCCCGA -64
Get sequence
Validated targets microrna.org: MIMAT0004567
TargetScanVert: hsa-miR-219a-1-3p
miRDB: MIMAT0004567