MirGeneDB

MirGeneDB ID

Hsa-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr1: 209432166-209432224 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACAACCAUGAGGCCU
Get precursor sequence
Structure
        10            20        30        40        50         
GAUCCUCAGACAAUCCAU----|   UU      UC           C        UCUCAU 
                      GUGC  CUCUUG  CUUCAUUCCAC GGAGUCUG      \
                      UACG  GAGGAC  GAAGUGAGGUG CUUUAGAC      A
UCCGGAGUACCAACAGUCGAGG^   --      UU           A        CAACCC 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-205-P1_5p

MirBase accessionMIMAT0000266
Sequence
0- UCCUUCAUUCCACCGGAGUCUGU -23
Get sequence
Validated targets microrna.org: MIMAT0000266
TargetScanVert: hsa-miR-205-5p
TargetMiner: hsa-miR-205-5p
miRDB: MIMAT0000266
Star sequence

Hsa-Mir-205-P1_3p*

MirBase accessionMIMAT0009197
Sequence
38- AUUUCAGUGGAGUGAAGUUCA -59
Get sequence
Validated targets microrna.org: MIMAT0009197
TargetScanVert: hsa-miR-205-3p
TargetMiner: hsa-miR-205-3p
miRDB: MIMAT0009197