MirGeneDB

MirGeneDB ID

Hsa-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-19b-2
Paralogues Hsa-Mir-19-P1  Hsa-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chrX: 134169683-134169748 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 134169382-134169446 [-] UCSC Ensembl
Mir-92-P1b chrX: 134169544-134169604 [-] UCSC Ensembl
Mir-19-P2b chrX: 134169683-134169748 [-] UCSC Ensembl
Mir-17-P3b chrX: 134169812-134169872 [-] UCSC Ensembl
Mir-17-P2b chrX: 134170042-134170106 [-] UCSC Ensembl
Mir-17-P1b chrX: 134170208-134170266 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAUAUUCAAAGACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGUGUGCUUCCUACGUCUGUG
Get precursor sequence
Structure
        10        20          30         40         50        60   
GAAUAUUCAAAGACAUUGCUAC--                 -  -|     UUU    GUAUAUAU 
                        UUACAAUUAGUUUUGCA GG UUUGCA   CAGC        \
                        AGUGUUAGUCAAAACGU CC AAACGU   GUCG        G
GUGUCUGCAUCCUUCGUGUGUAAU                 A  U^     ---    GUGUAUAU 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-19-P2b_5p*

MirBase accessionMIMAT0004492
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Validated targets microrna.org: MIMAT0004492
TargetScanVert: hsa-miR-19b-2-5p
TargetMiner: hsa-miR-19b-2-5p
miRDB: MIMAT0004492
Mature sequence

Hsa-Mir-19-P2b_3p

MirBase accessionMIMAT0000074
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence
Validated targets microrna.org: MIMAT0000074
TargetScanVert: hsa-miR-19b-3p
TargetMiner: hsa-miR-19b-3p
miRDB: MIMAT0000074