MirGeneDB

MirGeneDB ID

Hsa-Mir-146-P2

Family name MIR-146 (all species)
Seed GAGAACU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-146b
Paralogues Hsa-Mir-146-P1 
Orthologues Aca-Mir-146-P2  Ami-Mir-146-P2  Bta-Mir-146-P2  Cfa-Mir-146-P2  Cli-Mir-146-P2  Cpi-Mir-146-P2  Cpo-Mir-146-P2  Dno-Mir-146-P2  Dre-Mir-146-P2  Ete-Mir-146-P2  Gga-Mir-146-P2  Mdo-Mir-146-P2  Mml-Mir-146-P2  Mmu-Mir-146-P2  Oan-Mir-146-P2  Ocu-Mir-146-P2  Rno-Mir-146-P2  Sha-Mir-146-P2  Tgu-Mir-146-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr10: 102436520-102436578 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGCUGAAAGAACUUUGGCCACCUGGCACUGAGAACUGAAUUCCAUAGGCUGUGAGCUCUAGCAAUGCCCUGUGGACUCAGUUCUGGUGCCCGGCAGUGCUACAACAUCAAUGCCAAG
Get precursor sequence
Structure
        10             20        30        40        50          
CAGGCUGAAAGAACUUUG-----|  ACCU      G        AU        CU  GAGCU 
                       GCC    GGCACU AGAACUGA  UCCAUAGG  GU     \
                       CGG    CCGUGG UCUUGACU  AGGUGUCC  UA     C
GAACCGUAACUACAACAUCGUGA^  C---      -        C-        CG  ACGAU 
       110       100           90         80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut -1 on the 3p arm relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-146-P2_5p

MirBase accessionMIMAT0002809
Sequence
0- UGAGAACUGAAUUCCAUAGGCUGU -24
Get sequence
Validated targets microrna.org: MIMAT0002809
TargetScanVert: hsa-miR-146b-5p
TargetMiner: hsa-miR-146b-5p
miRDB: MIMAT0002809
Star sequence

Hsa-Mir-146-P2_3p*

MirBase accessionMIMAT0004766
Sequence
37- GCCCUGUGGACUCAGUUCUGGU -59
Get sequence
Validated targets microrna.org: MIMAT0004766
TargetScanVert: hsa-miR-146b-3p
TargetMiner: hsa-miR-146b-3p
miRDB: MIMAT0004766