MirGeneDB

MirGeneDB ID

Hsa-Mir-135-P3

Family name MIR-135 (all species)
Seed AUGGCUU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-135b
Paralogues Hsa-Mir-135-P1  Hsa-Mir-135-P2 
Orthologues Aca-Mir-135-P3  Ami-Mir-135-P3  Bta-Mir-135-P3  Cfa-Mir-135-P3  Cli-Mir-135-P3  Cpi-Mir-135-P3  Cpo-Mir-135-P3  Dno-Mir-135-P3  Dre-Mir-135-P3a  Dre-Mir-135-P3b  Ete-Mir-135-P3  Gga-Mir-135-P3  Mdo-Mir-135-P3  Mml-Mir-135-P3  Mmu-Mir-135-P3  Oan-Mir-135-P3  Ocu-Mir-135-P3  Rno-Mir-135-P3  Sha-Mir-135-P3  Sto-Mir-135-P3  Tgu-Mir-135-P3  Xtr-Mir-135-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(hg38)
chr1: 205448323-205448383 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGCUGGACCCCUCCACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCCUUCUCCUGC
Get precursor sequence
Structure
        10         20         30        40        50        60
GCCGCUGGACCCCUCCA-    -|                  CAU          UUGCUG 
                  CUCU GCUGUGGCCUAUGGCUUUU   UCCUAUGUGA      U
                  GGGA UGACAUCGGGUACCGAAAA   GGGAUGUACU      C
CGUCCUCUUCCUCGAGCG    G^                  UC-          CAAACC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-135-P3_5p

MirBase accessionMIMAT0000758
Sequence
0- UAUGGCUUUUCAUUCCUAUGUGA -23
Get sequence
Validated targets microrna.org: MIMAT0000758
TargetScanVert: hsa-miR-135b-5p
TargetMiner: hsa-miR-135b-5p
miRDB: MIMAT0000758
Star sequence

Hsa-Mir-135-P3_3p*

MirBase accessionMIMAT0004698
Sequence
39- AUGUAGGGCUAAAAGCCAUGGG -61
Get sequence
Validated targets microrna.org: MIMAT0004698
TargetScanVert: hsa-miR-135b-3p
TargetMiner: hsa-miR-135b-3p
miRDB: MIMAT0004698