MirGeneDB

MirGeneDB ID

Hme-Mir-9-o8

Family name MIR-9 (all species)
Seed CUUUGGU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-9b
Paralogues Hme-Mir-9-o7  Hme-Mir-9-o9  Hme-Mir-9-o10 
Orthologues Aae-Mir-9-P8  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P8  Dme-Mir-9-P8  Dmo-Mir-9-P8  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) H. melpomene
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
HE670875: 766577-766635 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGCGACUCGUCUACCGACAGGCUAAUUAUCUUUGGUUUUCUAGCUGUAUGAGUAUUGAGACAUCAUAAAGCUAGGUUACCGGAGUUAAGGGCCGUCUUUGAUCUACAAUGUCAUAAC
Get precursor sequence
Structure
        10            20        30        40        50         
UCAGCGACUCGUCUACC----|  A    AA   U       UU       G     GUAUU 
                     GAC GGCU  UUA CUUUGGU  UCUAGCU UAUGA     \
                     CUG CCGG  AAU GAGGCCA  GGAUCGA AUACU     G
CAAUACUGUAACAUCUAGUUU^  -    G-   U       UU       A     ACAGA 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-9-o8_5p

MirBase accessionMIMAT0025002
Sequence
0- UCUUUGGUUUUCUAGCUGUAUGA -23
Get sequence
Star sequence

Hme-Mir-9-o8_3p*

MirBase accessionNone
Sequence
36- AUAAAGCUAGGUUACCGGAGUUA -59
Get sequence