MirGeneDB

MirGeneDB ID

Hme-Mir-9-o7

Family name MIR-9 (all species)
Seed CUUUGGU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-9a
Paralogues Hme-Mir-9-o8  Hme-Mir-9-o9  Hme-Mir-9-o10 
Orthologues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P7  Dme-Mir-9-P7  Dmo-Mir-9-P7  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) H. melpomene
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
HE669612: 10319-10377 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-o7)
Mir-9-o9 HE669612: 9693-9752 [-] Ensembl
Mir-306 HE669612: 9837-9892 [-] Ensembl
Mir-9-o7 HE669612: 10319-10377 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AACCGCACGCCGCGUCCGGCGCGGCUCGUCUCUUUGGUAUCCUAGCUGUAGGCGUGUCCUCGUACCCUAAAGUUAUGGUACCGAAGUUACGAGCCGUACCGCGCCUCCACCGAGCGCGG
Get precursor sequence
Structure
        10          20        30        40        50         
AACCGCACGCCGCGUCC--| CG        CU          C     G    CGUGUC 
                   GG  CGGCUCGU  CUUUGGUAUC UAGCU UAGG      \
                   CC  GCCGAGCA  GAAGCCAUGG AUUGA AUCC      C
GGCGCGAGCCACCUCCGCG^ AU        UU          U     A    CAUGCU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-9-o7_5p

MirBase accessionMIMAT0025003
Sequence
0- UCUUUGGUAUCCUAGCUGUAGG -22
Get sequence
Star sequence

Hme-Mir-9-o7_3p*

MirBase accessionMIMAT0025003
Sequence
37- UAAAGUUAUGGUACCGAAGUUA -59
Get sequence