MirGeneDB

MirGeneDB ID

Hme-Mir-9-o10

Family name MIR-9 (all species)
Seed UAAAGCU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues Hme-Mir-9-o7  Hme-Mir-9-o8  Hme-Mir-9-o9 
Orthologues Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) H. melpomene
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
HE671859: 114241-114299 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCUUUUCAGCAUAUUUCACUUUUCGUGUAUUUGGUGAUUCAGCUUAUGACGUUACAAUAUACGUUAUAAAGCUGUUUCACUAAAUGUACGCGUAGUGAAAUUCAACAAAUGGUGUAA
Get precursor sequence
Structure
        10          20        30        40         50        
UUUCUUUUCAGCAUAUU--     UUU              UU    -|     CGUUAC 
                   UCACU   CGUGUAUUUGGUGA  CAGC UUAUGA      A
                   AGUGA   GCAUGUAAAUCACU  GUCG AAUAUU      A
AAUGUGGUAAACAACUUAA     UGC              UU    A^     GCAUAU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-9-o10_5p*

MirBase accessionNone
Sequence
0- AUUUGGUGAUUCAGCUUAUGA -21
Get sequence
Mature sequence

Hme-Mir-9-o10_3p

MirBase accessionNone
Sequence
37- AUAAAGCUGUUUCACUAAAUGU -59
Get sequence