MirGeneDB

MirGeneDB ID

Hme-Mir-279-o32

Family name MIR-279 (all species)
Seed GACUAGA
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-279b
Paralogues Hme-Mir-279-o31  Hme-Mir-279-o33  Hme-Mir-279-o34 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) H. melpomene
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE670979: 5122-5178 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o32)
Mir-279-o34 HE670979: 4653-4713 [-] Ensembl
Mir-279-o32 HE670979: 5122-5178 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAUAAUUGGAAAAAUUUUGCAAUCAGUUAAUGGGUAUAAGUCUAGUGUCACAGUGUGCAUUUGUGACUAGAUCUACACUCAUUGAUUGCUUGCAAACAAAUCUUCAAGAAGAAUU
Get precursor sequence
Structure
        10          20        30        40        50         
AAGAUAAUUGGAAAAAU--|      U            A  AG    GU      GUGU 
                   UUUGCAA CAGUUAAUGGGU UA  UCUA  GUCACA    \
                   AAACGUU GUUAGUUACUCA AU  AGAU  CAGUGU    G
UUAAGAAGAACUUCUAAAC^      C            C  CU    --      UUAC 
     110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-279-o32_5p*

MirBase accessionNone
Sequence
0- AAUGGGUAUAAGUCUAGUGUCACA -24
Get sequence
Mature sequence

Hme-Mir-279-o32_3p

MirBase accessionMIMAT0024964
Sequence
35- UGACUAGAUCUACACUCAUUGA -57
Get sequence