MirGeneDB

MirGeneDB ID

Hme-Mir-2-P4f

Family name MIR-2 (all species)
Seed AUCACAG
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-13b
Paralogues Hme-Mir-2-o63-v1  Hme-Mir-2-o63-v2  Hme-Mir-2-o64-v1  Hme-Mir-2-o64-v2  Hme-Mir-2-o65  Hme-Mir-2-P4e  Hme-Mir-2-P7  Hme-Mir-2-P8 
Orthologues Aae-Mir-2-P4  Dpu-Mir-2-o4 
Node of Origin (locus) Endopterygota
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE671256: 344775-344830 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4f)
Mir-71 HE671256: 336024-336085 [+] Ensembl
Mir-2-o63-v2 HE671256: 344481-344540 [+] Ensembl
Mir-2-o63-v1 HE671256: 344483-344538 [+] Ensembl
Mir-2-P4e HE671256: 344637-344695 [+] Ensembl
Mir-2-P4f HE671256: 344775-344830 [+] Ensembl
Mir-2-o64-v2 HE671256: 344897-344955 [+] Ensembl
Mir-2-o64-v1 HE671256: 344898-344954 [+] Ensembl
Mir-2-o65 HE671256: 345032-345089 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUAGGUAUUUGGAGAGUCUGUGGCCCAUUCGUAAAAAUGGCUGUGCCAUGGUACAUAUUCAUAUCACAGCCAUUUUUGACGAGUUGGGCUGCGGGGCAGUUCUCUGGCAUCUUA
Get precursor sequence
Structure
        10         20         30         40        50       
AUAUAGGUAUUUGGAGAG-    UG    -     -|             CC   GUAC 
                   UCUG  GCCC AUUCG UAAAAAUGGCUGUG  AUG    \
                   GGGC  CGGG UGAGC GUUUUUACCGACAC  UAC    A
AUUCUACGGUCUCUUGACG    GU    U     A^             UA   UUAU 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-2-P4f_5p*

MirBase accessionNone
Sequence
0- UCGUAAAAAUGGCUGUGCCAUG -22
Get sequence
Mature sequence

Hme-Mir-2-P4f_3p

MirBase accessionMIMAT0024941
Sequence
33- UAUCACAGCCAUUUUUGACGAGU -56
Get sequence