MirGeneDB

MirGeneDB ID

Gga-Mir-29-P2b-v1

Family name MIR-29 (all species)
Seed AGCACCA
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-29b-2
Paralogues Gga-Mir-29-P1a  Gga-Mir-29-P1b  Gga-Mir-29-P2a  Gga-Mir-29-P2b-v2 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Hme-Mir-29-P2  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2b  Oan-Mir-29-P2b-v1  Oan-Mir-29-P2b-v2  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2b  Tca-Mir-29-P2  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2  Xtr-Mir-29-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
26: 2699729-2699791 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2b-v1)
Mir-29-P1b 26: 2698824-2698883 [-] UCSC Ensembl
Mir-29-P2b-v1 26: 2699729-2699791 [-] UCSC Ensembl
Mir-29-P2b-v2 26: 2699730-2699790 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUACAUGCAAGAUCUGUCUUCCUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUCCCACUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUCUAGGAGCAAGAAUUACAGCGUGGGAGGAG
Get precursor sequence
Structure
        10          20          30        40        50        60 
CUACAUGCAAGAUCUGU--   C  -      -|         C      G  U   UUUUCCC 
                   CUU CU CUGGAA GCUGGUUUCA AUGGUG CU AGA       \
                   GAA GA GAUCUU UGACUAAAGU UACCAC GA UCU       A
GAGGAGGGUGCGACAUUAA   C  G      G^         U      -  -   AUGUUUC 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-29-P2b-v1_5p*

MirBase accessionMIMAT0031072
Sequence
0- CUGGUUUCACAUGGUGGCUUAGA -23
Get sequence
Validated targets TargetScanVert: gga-miR-29b-2-5p
miRDB: MIMAT0031072
Mature sequence

Gga-Mir-29-P2b-v1_3p

MirBase accessionMIMAT0001097
Sequence
40- UAGCACCAUUUGAAAUCAGUGUU -63
Get sequence
Validated targets TargetScanVert: gga-miR-29b-3p
miRDB: MIMAT0001097